View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6854_low_40 (Length: 264)

Name: NF6854_low_40
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6854_low_40
NF6854_low_40
[»] chr4 (1 HSPs)
chr4 (28-77)||(17725214-17725263)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 17725263 - 17725214
Alignment:
28 aatgtttgaatgcttcaaacattttaattgcagtagcttttaaggtatct 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
17725263 aatgtttgaatgcttcaaacattttaattgcagtagcttttaaggtatct 17725214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University