View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6854_low_45 (Length: 237)

Name: NF6854_low_45
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6854_low_45
NF6854_low_45
[»] chr1 (1 HSPs)
chr1 (1-222)||(44625334-44625555)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44625555 - 44625334
Alignment:
1 tcatcccagctttttgcgtcccattcatcctcaacatcatcatcttcatccactacttcttcaacaacttcaggaagttcaactttgtcctccatctgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44625555 tcatcccagctttttgcgtcccattcatcctcaacatcatcatcttcatccactacttcttcaacaacttcaggaagttcaactttgtcctccatctgca 44625456  T
101 ccgactccacttcttcaaccttttccagttcctctgtatctaaatcagcagtagtttccgctgcttcaacattttcctctgtcttgacagcagcggcacc 200  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
44625455 ccgactccacttcttcaaccttttccagttcctctgtatctagatcagcagtagtttccgttgcttcaacattttcctctgtcttgacagcagcggcacc 44625356  T
201 gttatgatttcgattcgttgat 222  Q
    ||||||||||||||||||||||    
44625355 gttatgatttcgattcgttgat 44625334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University