View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_49 (Length: 229)
Name: NF6854_low_49
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 28 - 146
Target Start/End: Complemental strand, 47591787 - 47591669
Alignment:
| Q |
28 |
gattttggtaaggtgatgaaatgaatgaatgaaaactagtgttgtagagtggtaaaggacctatagaactagagtttctttttctttctttctcttatgc |
127 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47591787 |
gattttggtaagatgatgaaatgaatgaatgaaaactagtgttgtagagtggtaaaggacctatagaactagagtttctttttttttctttctcttatgc |
47591688 |
T |
 |
| Q |
128 |
ttgttaatgtgtttgtttt |
146 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47591687 |
ttgttaatgtgtttgtttt |
47591669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University