View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_52 (Length: 207)
Name: NF6854_low_52
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 4 - 200
Target Start/End: Complemental strand, 6026429 - 6026234
Alignment:
| Q |
4 |
tttgtgcattcagttcatttagtcgctttacttatttaatgaatgtaaaaagataaattnnnnnnncatctctactctcttgtgtggaaaattagcatga |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
6026429 |
tttgtgcattcagttcatttagtccctttacttatttaatgaacgcaaaaagataaattagaaaaacatctctactctcttgtgtgtaaaattagcatga |
6026330 |
T |
 |
| Q |
104 |
gatgtttttgtgaggaagttcatgtttgtatagtttttattgccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatatt |
200 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026329 |
gatgtttttgtgcggaagtttatgtttgtatagtttt-attgccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatatt |
6026234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University