View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_8 (Length: 636)
Name: NF6854_low_8
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 1e-86
Query Start/End: Original strand, 132 - 302
Target Start/End: Original strand, 28447982 - 28448152
Alignment:
| Q |
132 |
tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28447982 |
tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt |
28448081 |
T |
|
| Q |
232 |
ctatttctataggcgtcaggcctacagacctcccctctacatcgatgatgatggatgctagtggggccggg |
302 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28448082 |
ctatttctataggcatcagacctacagacctcccctctacatcgatgatgatggatgctagtggggccggg |
28448152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 456 - 559
Target Start/End: Original strand, 16060150 - 16060253
Alignment:
| Q |
456 |
ctatctttagggacttggaacagcccggaggagagcccgcacctcaaccagaggctgcgcagcctgggcaagttccagaagggccactggggaaagtctt |
555 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
16060150 |
ctatctttagggacttggaacagcccggaggagagcccgcacctcaaccagaggctgcgcagcatgggcaagttccagaagggccactaggggaagtctt |
16060249 |
T |
|
| Q |
556 |
tgag |
559 |
Q |
| |
|
|||| |
|
|
| T |
16060250 |
tgag |
16060253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 18690607 - 18690684
Alignment:
| Q |
135 |
gggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaat |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
18690607 |
gggctttggttggccttggcttcggtgttcctctctctgaggttcctagtttttgcgttggaagttacaaccttcaat |
18690684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University