View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6855_high_20 (Length: 321)
Name: NF6855_high_20
Description: NF6855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6855_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 47705186 - 47705506
Alignment:
| Q |
1 |
tcactaaagggtaattgatagttatccgaaacaatcacagggacacatccagtgtttatagactccacaagtctagggctagctacttcatagccacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705186 |
tcactaaagggtaattgatagttatccgaaacaatcacagggacacatccagtgtttatagactccacaagtctagggctagctacttcatagccacttg |
47705285 |
T |
 |
| Q |
101 |
gacacaagcaaaacttgctttttcccatgagtttaaagtacttaagnnnnnnnggaagatattcatacactagtacttctttatcttttcctttccattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705286 |
gacacaagcaaaacttgctttttcccatgagtttaaagtacttaagtttttttggaagatattcatacactagtacttctttatcttttcctttccattg |
47705385 |
T |
 |
| Q |
201 |
atctagtaatgtctttctaatcataccatgttcccctccagcaaagagagcaagtatagaacgattatttgggtctttgcttggaattggtgagctcaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47705386 |
atctagtaatgtctttctaatcataccatgttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaac |
47705485 |
T |
 |
| Q |
301 |
ttgtaaccttgtaggttcatt |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47705486 |
ttgtaaccttgtaggttcatt |
47705506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 82 - 119
Target Start/End: Complemental strand, 44629206 - 44629169
Alignment:
| Q |
82 |
gctacttcatagccacttggacacaagcaaaacttgct |
119 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
44629206 |
gctacttcataaccacttggacacaaacaaaacttgct |
44629169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University