View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6855_high_25 (Length: 265)
Name: NF6855_high_25
Description: NF6855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6855_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 34348945 - 34349195
Alignment:
| Q |
1 |
tgtgaccgttgtgctggtcaataaacgagttcttactttatttcaaagattattattgcatatgatacagtttggtggctttgagacttcattgtcattc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34348945 |
tgtgaccgctgtgctggtcaataaacgagttcttactttatttcaaagattattattgcatatgatacagtttggtggctttgagacttcattgtcattc |
34349044 |
T |
|
| Q |
101 |
actgtggctgcatttgtgtttattttcagtggt---atcatcatgccatgatggcttagaaaaacactgcacctatagttgttgatttttcatattgagt |
197 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34349045 |
attgtggctgcatgtgtgtttattttcagtggtatcatcatcatgccatgatggcttagaaaaacactgcacctgtagttgttgatttttcatattgagt |
34349144 |
T |
|
| Q |
198 |
gtttgaaagagagtgtcccgtagtgtgtgcagctagcaattttcttgatgt |
248 |
Q |
| |
|
||| ||||||||||||| | |||||||||| ||||||||||||||| |||| |
|
|
| T |
34349145 |
gttcgaaagagagtgtcacatagtgtgtgctgctagcaattttcttaatgt |
34349195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University