View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6855_low_36 (Length: 246)
Name: NF6855_low_36
Description: NF6855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6855_low_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 47706050 - 47705821
Alignment:
| Q |
17 |
acaaagaaggtgaaccaccattagtccatgatggacccatgagttcaatttacggcatcgagggacatttcatgactgaaattgagaatagattgagtcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706050 |
acaaagaaggtgaaccaccattagtccatgatggacccatgagttcaatttacggcatcgagggacatttcatgactgaaattgagaatagattgagtcc |
47705951 |
T |
 |
| Q |
117 |
attttcaacccacaatccagatgaggctcatgtctttatgctacccttaagtgttacaaacatggtgcactacctatacaatcctctcaccacctactct |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47705950 |
attttcgacccacaatccagatgaggctcatgtctttatgctacccttaagtgttacaaacatggtgcactacctatacaatcctctcaccacatactct |
47705851 |
T |
 |
| Q |
217 |
agggatcaaatcatgcatgtcaccgttgat |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
47705850 |
agggatcaaatcatgcatgtcaccattgat |
47705821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University