View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6855_low_42 (Length: 237)
Name: NF6855_low_42
Description: NF6855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6855_low_42 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 13300967 - 13301203
Alignment:
| Q |
1 |
aaaacaaatacattgagatggtaaatttataaaagcctaatttaaaggaaaacaaaaatatactaagttttagataaactatgaataatgtactgtcaag |
100 |
Q |
| |
|
|||||||||||||||||||| || ||| ||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13300967 |
aaaacaaatacattgagatgatacattcatataggcctaatttaaaggaaaataaaaatatactaagttttagataaactatgaataatgtactgccaag |
13301066 |
T |
|
| Q |
101 |
actttatgcgagcaagaacacactgatttgaacaccgcatcttcaattaaaatcttagttaaggcgttatatatatgagacatctcatttatatgttgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13301067 |
actttatgcgagcaagaacacactgatttgaacaccgcatcttcaattaaaatcttaattaaggcgttatatatatgagacatctcatttatatgttgct |
13301166 |
T |
|
| Q |
201 |
caacatcaactttttcatctttgatatatccaacacc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13301167 |
caacatcaactttttcatctttgatatacccaacacc |
13301203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 219
Target Start/End: Complemental strand, 12406151 - 12406104
Alignment:
| Q |
172 |
tatatgagacatctcatttatatgttgctcaacatcaactttttcatc |
219 |
Q |
| |
|
|||||| | ||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
12406151 |
tatatgggtcatctcacttatatattgctcaacatcaactttttcatc |
12406104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 220
Target Start/End: Complemental strand, 21685303 - 21685269
Alignment:
| Q |
186 |
catttatatgttgctcaacatcaactttttcatct |
220 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21685303 |
catttatatgttgttcaacatcaactttttcatct |
21685269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 207
Target Start/End: Original strand, 38015921 - 38015957
Alignment:
| Q |
171 |
atatatgagacatctcatttatatgttgctcaacatc |
207 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38015921 |
atatatgagtcatctcacttatatgttgctcaacatc |
38015957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University