View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6855_low_49 (Length: 219)
Name: NF6855_low_49
Description: NF6855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6855_low_49 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 12216162 - 12215940
Alignment:
| Q |
1 |
tcggtaacatcaatataatctcgaatgcatgttccatcaggtgtgttataatctgttcctgtaacctgcaaggtggcaacagatgcaatgagcatagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216162 |
tcggtaacatcaatataatctcgaatgcatgttccatcaggtgtgttataatctgttcctgtaacctgcaaggtggcaacagatgcaatgagcatagggt |
12216063 |
T |
 |
| Q |
101 |
cattttacatcacggcat----attagtctagagccatacaagaattgaagtaacttgggcaaaaatcacttcatgttttccacgagagctagtaaaaaa |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216062 |
cattttacatcacggcatattaattagtctagagccatacaagaattgaagtaacttgggcaaaaatcacttcatgttttccacgagagctagtaaaaaa |
12215963 |
T |
 |
| Q |
197 |
catattcatgttgcaacttattt |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12215962 |
catattcatgttgcaacttattt |
12215940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 37051938 - 37051874
Alignment:
| Q |
7 |
acatcaatataatctcgaatgcatgttccatcaggtgtgttataatctgttcctgtaacctgcaa |
71 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||| ||||| ||||||||| |||||||||| |
|
|
| T |
37051938 |
acatcaatataatctcgtatgcaagttccatcacttgtcttatagtctgttcctctaacctgcaa |
37051874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University