View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_high_21 (Length: 252)
Name: NF6856_high_21
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 111 - 236
Target Start/End: Original strand, 2625175 - 2625298
Alignment:
| Q |
111 |
gtgggaatatcggccagagactcttacaaaccgactcgcccagttggatagagaggggaccaaatctcccttttccgggaacttctcgcattgcgcgaag |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2625175 |
gtgggaatatcggacagagactcttacaaaccgactcacccagttggatagag--gggaccgaatctgccttttccgggaacttcttgcattgcgcgaag |
2625272 |
T |
|
| Q |
211 |
aatatccacaaaactgaccccctgat |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2625273 |
aatatccacaaaactgaccccctgat |
2625298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 31772838 - 31772896
Alignment:
| Q |
16 |
ttatatctcggatggccgagctggacccagaccctttctgggttgaaaaccgaaccagc |
74 |
Q |
| |
|
||||||||| ||||| |||||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
31772838 |
ttatatctcagatgggcgagctggaccccgaccctttctaggttgaaaaccgaatcagc |
31772896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University