View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_high_27 (Length: 239)
Name: NF6856_high_27
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41213983 - 41213752
Alignment:
| Q |
1 |
ctggataagaactccagcagttccaaaaaatattagtgggattgctgttatgtagttatctcccaccaacttttgtcttttaatatagtgtgctctacta |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41213983 |
ctggatgagaactccagcagttccaaaaaatattagtgggattgctgttatgtagttatctcccaccaacttttgtctcttaatatagtgtgctctacta |
41213884 |
T |
|
| Q |
101 |
ttaatcttgctagtacag-aaacaagacatgaatctgatttagacattttatttcaattccgtttatgatcctaatgcagagtgatattgagcttttgca |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
41213883 |
ttaatcttgctagtacagaaaacaagacatgaatctgatttagacattttatttcaattccgtttatgatcctaatgcagagtgatactgagtttttgca |
41213784 |
T |
|
| Q |
200 |
cgttcgcagtgcaagatttcttaagttgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
41213783 |
cgttcgcagtgcaagatttcttaagtttatgt |
41213752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 159
Target Start/End: Complemental strand, 41216351 - 41216195
Alignment:
| Q |
3 |
ggataagaactccagcagttccaaaaaatattagtgggattgctgttatgtagttatctcccaccaacttttgtcttttaatatagtgtgctctactatt |
102 |
Q |
| |
|
|||| ||||||| |||| ||||| |||| ||||||||||||| ||| |||| || ||||| |||| |||||||| |||||||||||| | || |||| |
|
|
| T |
41216351 |
ggatgagaactcaagcacttccagaaaagattagtgggattgttgtcatgtgcttctctcctaccacattttgtctcttaatatagtgtaccgtattatt |
41216252 |
T |
|
| Q |
103 |
aatcttgctagtacagaaacaagacatgaatctgatttagacattttatttcaattc |
159 |
Q |
| |
|
|||||||||||| |||| |||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
41216251 |
aatcttgctagtgcagacacaagaaatgaatatgatttagacattgtatttcaattc |
41216195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University