View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_high_28 (Length: 231)
Name: NF6856_high_28
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 49 - 202
Target Start/End: Original strand, 6358338 - 6358491
Alignment:
| Q |
49 |
ccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcacaaggttaagcttatggggatttacacattttgtttt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358338 |
ccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcacaaggttaagcttatggggatttacacattttgtttt |
6358437 |
T |
 |
| Q |
149 |
agatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358438 |
agatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
6358491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University