View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_low_12 (Length: 391)
Name: NF6856_low_12
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 8e-77; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 24 - 177
Target Start/End: Original strand, 48192822 - 48192975
Alignment:
| Q |
24 |
ttaatgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaacaaggcattttttcaacaccctctacatgcttgc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
48192822 |
ttaatgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaacatggcattttttcaacaccctctacacgcttgc |
48192921 |
T |
 |
| Q |
124 |
aggttttttactgcacattccgtctgttctttaactcaaatggcgagcaatata |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48192922 |
aggttttttactgcacattccgtctgttctttaactcaaatggcgagcaatata |
48192975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 27 - 174
Target Start/End: Complemental strand, 54158698 - 54158552
Alignment:
| Q |
27 |
atgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaacaaggcattttttcaacaccctctacatgcttgcagg |
126 |
Q |
| |
|
||||||||| ||| ||||||||||||| |||||||| || |||| |||||||||||||||||| | |||||||||||||||||||| | ||||||||| |
|
|
| T |
54158698 |
atgtctgcccctatttcaaaattattgttaaaaatgcccttgttcttcaattaggttggcgaatatagcattttttcaacaccctctgcgcgcttgcagg |
54158599 |
T |
 |
| Q |
127 |
ttttttactgcacattccgtctgttctttaactcaaatggcgagcaat |
174 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
54158598 |
ctttttactgcacattctgtctgtt-tttaactcaaatggcgagcaat |
54158552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 198 - 229
Target Start/End: Original strand, 48192995 - 48193026
Alignment:
| Q |
198 |
caagctcttcttttgaaatggcgagcaagcca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48192995 |
caagctcttcttttgaaatggcgagcaagcca |
48193026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 91
Target Start/End: Complemental strand, 33813539 - 33813475
Alignment:
| Q |
27 |
atgtctgccactagttcaaaattattgataaaaatgtccctgttgttcaattaggttggcgaaca |
91 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||| ||||||| |||| || ||||||||||| |
|
|
| T |
33813539 |
atgtctgcccctagtttaaaattattgatagaaatgcccctgttcttcattttagttggcgaaca |
33813475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University