View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_low_17 (Length: 333)
Name: NF6856_low_17
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 37136496 - 37136831
Alignment:
| Q |
1 |
tttatcttcttcatcattatcattttctttactcttatcttcttgttaccctaagaagattgatgatccaaaccattatgattataatcttctagagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136496 |
tttatcttcttcatcattatcattttctttactcttatcttcttgttaccctaagaagattgatgatccaaaccattatgattataatcttctagagaac |
37136595 |
T |
 |
| Q |
101 |
aactctggttctgctaataatcacaacaccaatccatgtccacaattcaacttttccaatgatgaaaacattgagattaatgaaactcttgctttgcaaa |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136596 |
aactctggttctgctaacaatcacaacaccaatccatgtccacaattcaacttttccaatgatgaaaacattgagattaatgaaactcttgctttgcaaa |
37136695 |
T |
 |
| Q |
201 |
aatcaccttcactttcaccttatccatct---tcatcaaatcttttcaaccagaattttactcctccaagtgattcaaatgattaccaatactctgaaaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37136696 |
aatcaccttcactttcaccttatccatcttcatcatcaaatcttttcaaccagaattttactcctccaagtgattcacatgattaccaatactctgaaaa |
37136795 |
T |
 |
| Q |
298 |
tttgagctttgaacatcatggattcaatgcaggatc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136796 |
tttgagctttgaacatcatggattcaatgcaggatc |
37136831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University