View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_low_18 (Length: 302)
Name: NF6856_low_18
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 176 - 280
Target Start/End: Complemental strand, 18742104 - 18742000
Alignment:
| Q |
176 |
agaagaacatctaaaaatttggcaaattgaaacatttttggaggaaagcttgaaaaactagggtagaaagaatagccaaaaataagttgttacattttcc |
275 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18742104 |
agaaggacatctaaaaatttggcaaattgaaacgtttttggaggaaagcttgaaaaactagggtagaaagaagagccaaaaagaagttgttacattttcc |
18742005 |
T |
 |
| Q |
276 |
tatgg |
280 |
Q |
| |
|
||||| |
|
|
| T |
18742004 |
tatgg |
18742000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University