View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6856_low_23 (Length: 261)
Name: NF6856_low_23
Description: NF6856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6856_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 242
Target Start/End: Complemental strand, 55336980 - 55336752
Alignment:
| Q |
14 |
ggacacataatttacaccatgatttatccaattctacaatcaataactccaacaccgtgcaactctatgctatcttagattctgtatctgacagaattga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55336980 |
ggacacataatttacaccatgatttatccaattcttcaatcaataactccaacaccgtgcaactctatgctatcttagattctgtatctgacagaattga |
55336881 |
T |
|
| Q |
114 |
aatgcacaaaaacatctgcgaacagcgtcaaaattggaacaacctacttctaaacaacattaacatgattacactcactgctacaacattaactggtatt |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55336880 |
aatgcacaaaaacatcggcgaacagcgtcaaaattggaacaacctacttctaaacaacattaacatgattacactcactgctacaacattaacttgtatt |
55336781 |
T |
|
| Q |
214 |
gcagccgcaactggtgctgatggtgcaca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55336780 |
gcagccgcaactggtgctgatggtgcaca |
55336752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 71 - 231
Target Start/End: Complemental strand, 55331485 - 55331325
Alignment:
| Q |
71 |
tgcaactctatgctatcttagattctgtatctgacagaattgaaatgcacaaaaacatctgcgaacagcgtcaaaattggaacaacctacttctaaacaa |
170 |
Q |
| |
|
||||||||||||| || |||||||||||||| |||||||| ||||||||||| ||| || || ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
55331485 |
tgcaactctatgcaattttagattctgtatccgacagaatcgaaatgcacaacaacctcagccaacagcgacagaattggaacaacctacttctaaacaa |
55331386 |
T |
|
| Q |
171 |
cattaacatgattacactcactgctacaacattaactggtattgcagccgcaactggtgct |
231 |
Q |
| |
|
||| |||||||| ||||| ||||||||||||||||| ||| ||| || |||| ||||||| |
|
|
| T |
55331385 |
catcaacatgatcacacttactgctacaacattaaccggtgttgtggctgcaagtggtgct |
55331325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University