View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6857_low_11 (Length: 263)
Name: NF6857_low_11
Description: NF6857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6857_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 47713166 - 47713431
Alignment:
| Q |
1 |
ctcttcactcatcaaagagtcttcatcggtataatcgtgaagtaccgaaaaggggttttggattttcttaaccggagggggtttaacttgaaccaaaggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47713166 |
ctcttcactcatcaaagagtcttcatcagtataatcgtgaagtaccgaaaaggggttttggattttcttaaccagagggggtttaacttgaaccaaaggg |
47713265 |
T |
 |
| Q |
101 |
ggtttaaactcccattgttcttgatcgaattttctaacaccaaaacgggttttt------------------gatttgcgannnnnnnnnctgtaggctg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
47713266 |
ggtttaaactcccattgttcttgatcgaattttcttacaccaaagcgggtttttgattttgattttgactttgatttgcgatttttttttctgtaggctg |
47713365 |
T |
 |
| Q |
183 |
ctaatttcttttgattccattcttctttctggattttacgtatattggtaccttgcagaagacggt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47713366 |
ctaatttcttttgattccattcttctttctggattttacgtatattggtaccttgcagaagacggt |
47713431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University