View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6857_low_12 (Length: 248)
Name: NF6857_low_12
Description: NF6857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6857_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 20 - 160
Target Start/End: Complemental strand, 25867677 - 25867537
Alignment:
| Q |
20 |
gttgtgtcagatactgacacgtgttagagacgggaaacaccttcaatattcagtgtcagtgctacatagtgtgttaccaatatgtgtgttgagtttggac |
119 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25867677 |
gttgtgtcggatactgacacgtgtcagagacgggaaacaccttcaatattcagtgtcggtgctacatagtgtgttaccaatatgagtgttgagtttggac |
25867578 |
T |
|
| Q |
120 |
tgccttaagtgatggagagcatgttactcactaaattgaac |
160 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25867577 |
taccttaagtgatggagagtatgttactcactaaattgaac |
25867537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 248
Target Start/End: Complemental strand, 25867487 - 25867452
Alignment:
| Q |
213 |
atgctccttgaaaaagagagtgtgatactaattttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25867487 |
atgctccttgaaaaagagagtgtgatactaattttt |
25867452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University