View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6857_low_16 (Length: 228)
Name: NF6857_low_16
Description: NF6857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6857_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 43356421 - 43356235
Alignment:
| Q |
22 |
cacatatatattatcaacttgctttgaaaattcaactccatataaccaagactccacacccattggagagcatagaggagacagagctacactatttcta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356421 |
cacatatatattatcaacttgctttgaaaattcaactccatataaccaagactccacacccattggagagcatagaggagacagagctacactatttcta |
43356322 |
T |
|
| Q |
122 |
tttccnnnnnnnattgggatttctatttctgcataccatgtgcccacgatccttgagcataattgatgatatttttatgatattcag |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356321 |
tttcctttttttattgggatttctatttctgcataccatgtgcccacgatccttgagcataattgatgatatttttatgatattcag |
43356235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University