View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6857_low_18 (Length: 226)
Name: NF6857_low_18
Description: NF6857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6857_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 24423875 - 24424094
Alignment:
| Q |
1 |
ctcaggttaatatagtttacaccaatttcaagtgtcattatagtatcccacatctgaaatcattggaaaacttgaaagaactataccgatgcccacctct |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
24423875 |
ctcaggttaatatagtgtacaccaatttcaagtgtcattatagtatctcacatctgaaatcattggaaaacttgaaagaactacgtcgaggcccacctct |
24423974 |
T |
|
| Q |
101 |
gcaagtgctacacttttttcaaaaattatcttttcttgcaattgaagaatctatttccacctgaatgtcaattaagaaatctcacaagactcataataaa |
200 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24423975 |
gcaagtgctacagttttttgaaaaattatcttttcttgcaattgaagaatctatttccaccggaatgtcaattaagaaatctcacaagactcatgataaa |
24424074 |
T |
|
| Q |
201 |
ggatttcaatggtggtcaaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24424075 |
ggatttcaatggtggtcaaa |
24424094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University