View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6859_low_5 (Length: 296)
Name: NF6859_low_5
Description: NF6859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6859_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 46796044 - 46795749
Alignment:
| Q |
1 |
atagttattttcaaaaaatgtacttagtatagttagtacgtggtacttagtggttagttagtctgatcttttcaaagatagagataggtatctcagataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46796044 |
atagttattttcaaaaaatgtacttagtatagttagtacgtggtacttagcggttagttagtctgatcttttcaaagatagagataggtatctcagataa |
46795945 |
T |
 |
| Q |
101 |
atgtttatatataagtctatgggactgtacttggaccgttaagtataggagcagagaagctaccactgtgttgaattgtgatcttttccacacaatacct |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795944 |
atgattatatataagtctatgggactgtacttggaccgttaagtataggagcagagaagctaccactgtgttgaattgtgatcttttccacacaatacct |
46795845 |
T |
 |
| Q |
201 |
agggttttcaaccattggttccaaatgttctctttccctaataatttcccttcttcatcatcttcttcttcttaccctaatagtaccctttctttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795844 |
agggttttcaaccattggttccaaatgttctctttccctaataatttcccttcttcatcatcttcttcttcttaccctaatagtaccctttctttt |
46795749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University