View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_high_44 (Length: 299)
Name: NF6860_high_44
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 60 - 281
Target Start/End: Complemental strand, 43426713 - 43426492
Alignment:
| Q |
60 |
ataggtaatgatcaaagaggaggagttatcttgatcattgagtttagaaatgaagaaaccatggctgagtcaactcgctaaagaagttgacattaagagt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43426713 |
ataggtaatgatcaaagaggaggagttatcttgatcattgagtttagaaatgaagaaaccatggctgagtcaactcgctaaagaagttgacattaagagt |
43426614 |
T |
 |
| Q |
160 |
aaaacagggaaaaattcacaaagtagaatttagagaaccaagttggtttagtgagttttgagtacaaataggaattacttgaaggtgaagaaagagcaac |
259 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
43426613 |
aaaacagggtaaaattcacaaagcagaatttagagaaccaagttggtttagtgagttttgagtacaactaggaattacttcaaggtgaagaaagagcaac |
43426514 |
T |
 |
| Q |
260 |
ttgctaaacgaactacaatttc |
281 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
43426513 |
ttgctaagcgaactacaatttc |
43426492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University