View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_high_49 (Length: 274)
Name: NF6860_high_49
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 3 - 261
Target Start/End: Complemental strand, 47136572 - 47136314
Alignment:
| Q |
3 |
attcaatatcatcgatatatttgtcaactgtcaaattctgattgtgactcactttgtaaataaaatttcagcaattggtgcaatatttgctgcaacagat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47136572 |
attcaatatcatcgatatatttgtcaactgtcaaattctgattgtgactcactttgtaaataaaatttcagcaattggtgcaatatttgctgcaacagat |
47136473 |
T |
|
| Q |
103 |
tctgtgtgcacgttgcaggtttgtaacaacaatctttactctctctatgttccagagcaactataagatgtcaatgctaagtactgaagttttaaatgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47136472 |
tctgtgtgcacgttgcaggtttgtaacaacaatctttactctatctatgtttcagagcaactataagatgtcaatgctaagtactgaagttttaaatgat |
47136373 |
T |
|
| Q |
203 |
gattatgcaggtgctaaaccaggatgagacacctttactatacagtcttgtatttggcg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47136372 |
gattatgcaggtgctaaaccaggatgagacacctttactatacagtcttgtatttggcg |
47136314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 36489880 - 36489932
Alignment:
| Q |
207 |
atgcaggtgctaaaccaggatgagacacctttactatacagtcttgtatttgg |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | || |||||||||||||| |
|
|
| T |
36489880 |
atgcaggtgctaaatcaggatgagacacctttattgtatagtcttgtatttgg |
36489932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 76 - 125
Target Start/End: Original strand, 36489759 - 36489808
Alignment:
| Q |
76 |
attggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggtttg |
125 |
Q |
| |
|
||||| ||||||||||| ||||||||||| || ||||| ||||||||||| |
|
|
| T |
36489759 |
attggagcaatatttgccgcaacagattccgtttgcacattgcaggtttg |
36489808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 71 - 122
Target Start/End: Complemental strand, 49207802 - 49207751
Alignment:
| Q |
71 |
cagcaattggtgcaatatttgctgcaacagattctgtgtgcacgttgcaggt |
122 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||| ||||| |||||||| |
|
|
| T |
49207802 |
cagcaattggagcaatattttcagcaacagattctgtttgcacattgcaggt |
49207751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University