View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_high_55 (Length: 253)
Name: NF6860_high_55
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 29552914 - 29553116
Alignment:
| Q |
1 |
tcatgtcagaagttgatttctttcggttttcattttggaatatagtttcctttttgatatcaattgcagtaatacttattttaactccagctggaaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29552914 |
tcatgtcagaagttgatttctttcggttttcattttggaatatagtttcctttttgatatcaattgcagtaataattattttaactccaactggaaaaga |
29553013 |
T |
|
| Q |
101 |
gggcagtccggtgtacgttccactgacttggtttgcccttagttatctatattctatgcgggtgatatcccc------tacacatttcaattctgtgttt |
194 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29553014 |
gggcagtccgatgtacgttccagtgacttggtttacccttagttatctatattctatgcgggtgatatcccccacgtatacacatttcaattctgtgttt |
29553113 |
T |
|
| Q |
195 |
gtt |
197 |
Q |
| |
|
||| |
|
|
| T |
29553114 |
gtt |
29553116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University