View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_high_64 (Length: 238)
Name: NF6860_high_64
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_high_64 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 6111537 - 6111299
Alignment:
| Q |
1 |
caatgaggcaagagctgcctaaagcttcacttcttgaacaagggtctaagagtagcatcttcgaagcataggttgtggagctctagttccatgctttggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111537 |
caatgaggcaagagctgcctaaagcttcacttcttgaacaagggtctaagagtagcatcttcgaagcataggttgtggagctctagttccatgctttggc |
6111438 |
T |
 |
| Q |
101 |
tgaaaatctagccatgtcaatat-ttttggcagtgatacacatgattttaagccaggagtagctctgcatgtttcaattgatattgatgttcactcggtt |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6111437 |
tgaaaatctagccatgtcaatattttttggcagtgatacacatgattttaagccaggagtagctctgcatgtttcaattgatattgatattcactcggtt |
6111338 |
T |
 |
| Q |
200 |
gcacttaacattggtgagtttggtgttccattttccttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111337 |
gcacttaacattggtgagtttggtgttccattttccttc |
6111299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University