View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6860_high_78 (Length: 219)

Name: NF6860_high_78
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6860_high_78
NF6860_high_78
[»] chr7 (2 HSPs)
chr7 (1-69)||(33711037-33711105)
chr7 (174-219)||(33711210-33711255)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 33711037 - 33711105
Alignment:
1 ataaacacaagaatattgtatgaaatggattatatcttcactctacaacaagcaagcttgttgagggag 69  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
33711037 ataaactcaagaatattgtaagaaatggattatatcttcactctacaacaagcaagcttgttgagggag 33711105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 33711210 - 33711255
Alignment:
174 tacctcaatgtgaagagtttgctgttgaacctgtggttgtgtgttt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
33711210 tacctcaatgtgaagagtttgctgttgaacctgtggttgtgtgttt 33711255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University