View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_28 (Length: 413)
Name: NF6860_low_28
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 3483044 - 3482849
Alignment:
| Q |
18 |
acattctcacacaccccttctaatcttcttcaatcaactcaaaatcctatgaattttttcatattcaactttctcatgttttttgtgattgttgattttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3483044 |
acattctcacacaccccttctaatcttcttcaatcaactcaaaatcctatgaattttttcatattcaactttctcatgttttttgtgattgttgattttg |
3482945 |
T |
|
| Q |
118 |
aatctcaggtatttcacgagattctatgcacaagagacgtgaaactggtggcaagaagaaggcatggaggaagaagagaaagtacgctttcaaacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3482944 |
aatctcaggtatttcacgagattctatgcacaagagacgtgaaactggtggcaagaagaaggcatggaggaagaagagaaagtacgctttcaaacc |
3482849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 232 - 279
Target Start/End: Complemental strand, 3482828 - 3482781
Alignment:
| Q |
232 |
atataatttatgaaattgaagctgatttatgtgttgaggttctgggtc |
279 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3482828 |
atataatttatgaaattgaagttgatttatgtgttgaggttctgggtc |
3482781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 14571624 - 14571698
Alignment:
| Q |
129 |
tttcacgagattctatgcacaagagacgtgaaactggtggcaagaagaaggcatggaggaagaagagaaagtacg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14571624 |
tttcacgagattctatgcacaagagacgtgaaactggtggcaagaagaaggcatggaggaagaagagaaagtacg |
14571698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 201
Target Start/End: Complemental strand, 18837847 - 18837769
Alignment:
| Q |
123 |
caggtatttcacgagattctatgcacaagagacgtgaaactggtggcaagaagaaggcatggaggaagaagagaaagta |
201 |
Q |
| |
|
|||||||||| | ||||| ||||||||||| |||| |||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
18837847 |
caggtatttccagggattccatgcacaagaggcgtgccactggtggcaagaagaagagctggagaaagaagcgaaagta |
18837769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University