View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_49 (Length: 290)
Name: NF6860_low_49
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_49 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 290
Target Start/End: Original strand, 29552541 - 29552815
Alignment:
| Q |
16 |
aatttgaagacaaagaactttgaggacaaaacagcattagacatagcaactacggagagcaagaaaatattatgcagtgccggagcaaaatctggcaccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29552541 |
aatttgaagacaaagaactttgaggacaaaacagcattagacgtagcaactacggagagcaagaaaatattatgcagtgccggagcaaaatctggcaccg |
29552640 |
T |
|
| Q |
116 |
aagtcatcgatgctcacacacctgcatataaactaagttcagagaccaccattattgataaactgtcaatttatatgcatcgcatatcacgaaatataac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29552641 |
aagtcatcgatgctcacacacctgcatataaactaagttcagagaccactattattgataaactgtcaatttatatgcttcgcatatcacgaaatataaa |
29552740 |
T |
|
| Q |
216 |
agatgagcaacgtaacactatgttgatagttgcagccctttttgtgactgcccactatcaaccagtcctaagtcc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
29552741 |
agatgagcaacgtaacactatgttgatagttgcagcccttgttgtgactgccacctatcaatcagtactaagtcc |
29552815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 6611202 - 6611154
Alignment:
| Q |
16 |
aatttgaagacaaagaactttgaggacaaaacagcattagacatagcaa |
64 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
6611202 |
aatttgaacacaatgaacttggagagcaaaacagcattagacatagcaa |
6611154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University