View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_63 (Length: 247)
Name: NF6860_low_63
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 31 - 227
Target Start/End: Complemental strand, 36468306 - 36468106
Alignment:
| Q |
31 |
gaaatcttatcaccgacattaacgaaggagtttcactattataatttagtggtaagtttcactaagtaaaaaagttattttnnnnnnnttagttgcaagt |
130 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
36468306 |
gaaatcttatcaccgacattaatgaaggagtttcactattataatttagtggtaagtttcactaagtaaaaaagttattttaaaaaaattagttacaagt |
36468207 |
T |
 |
| Q |
131 |
taataatgagttttataatatatgttttca----nnnnnnnnnggaaggaataatgtgacctcttattgcattttataaccgaacaaagattttgtaaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36468206 |
taataatgagttttataatatatgttttcattttattttttttggaaggaataatgtgacctcttattgcattttataaccgaacaaagattttgtaaat |
36468107 |
T |
 |
| Q |
227 |
c |
227 |
Q |
| |
|
| |
|
|
| T |
36468106 |
c |
36468106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 36468361 - 36468330
Alignment:
| Q |
1 |
aaaaataaatttttcaaaatagtctcttatga |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36468361 |
aaaaataaatttttcaaaatagtctcttatga |
36468330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University