View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_68 (Length: 238)
Name: NF6860_low_68
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 36223659 - 36223437
Alignment:
| Q |
1 |
taaagggtaccaagaagtggactaatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattatttt-tt |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36223659 |
taaagggtaccaagaagtggactcatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattattttatt |
36223560 |
T |
 |
| Q |
100 |
cttcttcttatgaacatttggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtggcaa |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223559 |
tttcttcttatgaacaattggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtggcaa |
36223460 |
T |
 |
| Q |
200 |
tttatttatctaacatagggaac |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36223459 |
tttatttatctaacatagggaac |
36223437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University