View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_83 (Length: 220)
Name: NF6860_low_83
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 52765291 - 52765474
Alignment:
| Q |
18 |
atgaaggttacgtagcacatgcaatgcgccagtaattacaaatgtagggaaattttcggtagagtttctgattcttccatatgcactaaaacaagcaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765291 |
atgaaggttacgtagcacatgcaatgcgccagtaattacaaatgtagggaaattttcggtagagtttctgattcttccatatgcactaaaacaagcaatc |
52765390 |
T |
|
| Q |
118 |
tatgaattgtgtatcattagccctattgtatgctatgtaccttaacctatatcattgggggcagtacatacttatagaaacatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52765391 |
tatgaattgtgtatcattagccctattgtatgctatgtaccttaacctatatcattgggggcagtacatacttatagaaacatt |
52765474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University