View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6860_low_84 (Length: 219)
Name: NF6860_low_84
Description: NF6860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6860_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 33711037 - 33711105
Alignment:
| Q |
1 |
ataaacacaagaatattgtatgaaatggattatatcttcactctacaacaagcaagcttgttgagggag |
69 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711037 |
ataaactcaagaatattgtaagaaatggattatatcttcactctacaacaagcaagcttgttgagggag |
33711105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 174 - 219
Target Start/End: Original strand, 33711210 - 33711255
Alignment:
| Q |
174 |
tacctcaatgtgaagagtttgctgttgaacctgtggttgtgtgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711210 |
tacctcaatgtgaagagtttgctgttgaacctgtggttgtgtgttt |
33711255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University