View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6861_high_4 (Length: 410)

Name: NF6861_high_4
Description: NF6861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6861_high_4
NF6861_high_4
[»] chr4 (2 HSPs)
chr4 (146-306)||(2601024-2601193)
chr4 (14-100)||(2600886-2600972)
[»] chr2 (1 HSPs)
chr2 (25-81)||(44510305-44510361)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 5e-69; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 146 - 306
Target Start/End: Original strand, 2601024 - 2601193
Alignment:
146 atatatatagaggtatgtagatgtttctagggttaatctgagtttgttatgtttgacgtgaattaacgagtgtttgttgtatcga--atatatggtagat 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
2601024 atatatatagaggtatgtagatgtttctagggttaatctgagtttgttatgtttgacgtgaattaacgagtgtttgttgtatcgaatatatatggtagat 2601123  T
244 aaatagatagatataactctaaacaa-------ttctagcgaatatagagtttagtttctatgtctatcg 306  Q
    ||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
2601124 aaatagatagatataactctaaacaaacaacagttctagcgaatatagagtttagtttctatgtctatcg 2601193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 2600886 - 2600972
Alignment:
14 ctgataagaatctatcatcccaaacaagaccagatgaacctgatcttctgaatgatacttcagatcttggtagaccagccatgatgt 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2600886 ctgataagaatctgtcatcccaaacaagaccagatgaacctgatcttctgaatgatacttcagatcttggtagaccagccatgatgt 2600972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 44510361 - 44510305
Alignment:
25 ctatcatcccaaacaagaccagatgaacctgatcttctgaatgatacttcagatctt 81  Q
    ||||||||||||||||  || |||||||||  |||||||||||||||| ||||||||    
44510361 ctatcatcccaaacaaaccctgatgaaccttgtcttctgaatgatactgcagatctt 44510305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University