View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6861_low_11 (Length: 296)
Name: NF6861_low_11
Description: NF6861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6861_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 40399952 - 40400138
Alignment:
| Q |
18 |
gtcaccgtgtcagaatttcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40399952 |
gtcaccgtgtcagaatttcatgtttatgattatccatgattctgaagtttcaactctcaaccatactatgcatgcagaccatggtccacatcccactacc |
40400051 |
T |
|
| Q |
118 |
agagttatggcgggttgacgctgagatttgaggttgaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40400052 |
agagttatggcgggttgacgctgagatgtgaggttcaaaatccatgttagtgtttctctaagttactatcatattggtacaaaatgt |
40400138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 286
Target Start/End: Original strand, 40400160 - 40400224
Alignment:
| Q |
218 |
ttaagaacgattgatttccgtcgaaaacctataggatatacaagatggattctttccttccaatcgtat |
286 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40400160 |
ttaagaacgattgattttcgtcgaaaacctataggatag----gatggattctttccttccaatcgtat |
40400224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University