View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6861_low_16 (Length: 245)

Name: NF6861_low_16
Description: NF6861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6861_low_16
NF6861_low_16
[»] chr7 (1 HSPs)
chr7 (75-232)||(10427203-10427361)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 10427361 - 10427203
Alignment:
75 tttgaaaacttaatttgagaatcttatttgcaaannnnnnnnnnnnttttataaaattttgattttgtt-ctcaaatagtaattgaagataactttattt 173  Q
    ||||||||||||||||||||||||||||||||||            ||||| ||||||||||||||||| |||||||||||||||||||||| | |||||    
10427361 tttgaaaacttaatttgagaatcttatttgcaaaacacacacactcttttagaaaattttgattttgtttctcaaatagtaattgaagataattctattt 10427262  T
174 gttaaaattcacaataaatagtcagcttcttgatgcatatccattaacattaacaacac 232  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
10427261 gttaaaattcataataaatagtcagcttcttgatgcatatccattaacattaacaacac 10427203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University