View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6861_low_16 (Length: 245)
Name: NF6861_low_16
Description: NF6861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6861_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 10427361 - 10427203
Alignment:
| Q |
75 |
tttgaaaacttaatttgagaatcttatttgcaaannnnnnnnnnnnttttataaaattttgattttgtt-ctcaaatagtaattgaagataactttattt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| | ||||| |
|
|
| T |
10427361 |
tttgaaaacttaatttgagaatcttatttgcaaaacacacacactcttttagaaaattttgattttgtttctcaaatagtaattgaagataattctattt |
10427262 |
T |
 |
| Q |
174 |
gttaaaattcacaataaatagtcagcttcttgatgcatatccattaacattaacaacac |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10427261 |
gttaaaattcataataaatagtcagcttcttgatgcatatccattaacattaacaacac |
10427203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University