View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_high_8 (Length: 312)
Name: NF6863A_high_8
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 172 - 300
Target Start/End: Complemental strand, 7303778 - 7303649
Alignment:
| Q |
172 |
ttgaccttgagccaaaatcttcacatgataatttctatttttatccaaaatgttaagtgaaagaaatttttaa-tggaatatttgttggcattaaagatt |
270 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
7303778 |
ttgaccttgagccaaattcttaccatgataatttctatttttatccaaaatgttaagtgaaaggaattttcaaatggaatatttgttggcattaaagatt |
7303679 |
T |
|
| Q |
271 |
atattgtggatatagaatttgagattaact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7303678 |
atattgtggatatagaatttgagattaact |
7303649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 28 - 145
Target Start/End: Complemental strand, 7303961 - 7303844
Alignment:
| Q |
28 |
tcttatgaactctaatattaagtttattaggagacaaacaaaccaagttgctcatagtttggctaggaaggcttcgcctatagcaaatttccgtattttc |
127 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
7303961 |
tcttatgaactctaatgttaagtttattaggagacaaacaaaccaagttgctcatagtttggttagggaggcttcgcctatagctaatttccgtattttc |
7303862 |
T |
|
| Q |
128 |
tataacattccaacatgt |
145 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7303861 |
tataacattccaacatgt |
7303844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 791947 - 791991
Alignment:
| Q |
49 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
93 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
791947 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
791991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 32639676 - 32639619
Alignment:
| Q |
28 |
tcttatgaactctaatattaagtttattaggagacaaacaaaccaagttgctcatagt |
85 |
Q |
| |
|
||||||||||||| ||||||| || ||||| |||||| ||||| || ||||||||||| |
|
|
| T |
32639676 |
tcttatgaactctgatattaaattaattagaagacaagcaaacaaaattgctcatagt |
32639619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 4052865 - 4052909
Alignment:
| Q |
49 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
93 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
4052865 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
4052909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 25070942 - 25070898
Alignment:
| Q |
49 |
gtttattaggagacaaacaaaccaagttgctcatagtttggctag |
93 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
25070942 |
gtttattcggagacaaaccaacgaagttgctcatagttttgctag |
25070898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University