View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_107 (Length: 284)
Name: NF6863A_low_107
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_107 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 25440009 - 25440282
Alignment:
| Q |
11 |
catagatcagaaaaaagaacaagtcctagaagagatagaggaaagcaaggctttctttcaggtattgacttctacctatgtggacaaagagctttgctac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25440009 |
catagatcagaaaaaagaacaagtcctagaagagatagaggaaagcaaggctttctttcaggtattgacttctacctatgtggacaaagagctttgctac |
25440108 |
T |
|
| Q |
111 |
ctttcaaagttcataaagtttatttatgctgtactcgattcaggtatacgatggtgcagtgtacctgcgtcaggggaaaacatatttggttgaaaaatta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25440109 |
ctttcaaagttcataaagtttatttatgctgtactcgattcaggtatacgatggtgcagtgtacctgcgtcaggggaaaacgtatttggttgaaaaatta |
25440208 |
T |
|
| Q |
211 |
gatctatctagcaaaactgctttctgcaaagaggctgatctgaagtattatacgaaaactcgagattacactga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25440209 |
gatctatctagcaaaactgctttctgcaaagaggctgatctgaagtattatacgaaaactcgagattacactga |
25440282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 244
Target Start/End: Complemental strand, 6691303 - 6691243
Alignment:
| Q |
184 |
gggaaaacatatttggttgaaaaattagatctatctagcaaaactgctttctgcaaagagg |
244 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6691303 |
gggaaaatgtatttggttgaaaaattagatctatctaacagaactgctttctgcaaagagg |
6691243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University