View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_121 (Length: 276)
Name: NF6863A_low_121
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_121 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 46 - 270
Target Start/End: Complemental strand, 34398076 - 34397854
Alignment:
| Q |
46 |
aagagggaatagttatttcagtccttggcaaaataactgacttgggtctctcataaaaacaacgtagcttttaaccgagcatttatcgaaacattgtttt |
145 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34398076 |
aagagagaatagttatttcagtccttggcaaaatatttgacctgggtctc--ataaaaacaatgtagcttttaacctagcatttatcgaaacattgtttt |
34397979 |
T |
|
| Q |
146 |
ttcttatggtatgtactattttctttcacagtcgattttgtcatcttgttgctatgttatgtaatcgaattaaaagataacggaacccctccaatgctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34397978 |
ttcttatggtatgtactattttctttcacagtcgattttgtcatcttgttgctatgttatgtaatcgaattaaaagataatggaacccctccaatgctct |
34397879 |
T |
|
| Q |
246 |
tgaatatgcaacaatggaggaaaac |
270 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34397878 |
tgaatatgcaacaatggaggaaaac |
34397854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 36703138 - 36703171
Alignment:
| Q |
1 |
atgaacaaaaacagatgggagaaaaacgattatc |
34 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
36703138 |
atgaacaaaaacagatgggagaagaacgattatc |
36703171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University