View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_129 (Length: 270)
Name: NF6863A_low_129
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_129 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 160
Target Start/End: Complemental strand, 5332378 - 5332234
Alignment:
| Q |
16 |
aagtattacatgaatttagtttcaagtcgcacatttactttagatttatatgcattgtccttattagctgagccaagctcacgaggacgcatttttgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
5332378 |
aagtattacatgaatttagtttcaagtcgcacatttactttaaatttatatgcattgtccttattagttgagctaagctcacgaggacgcatttttgttt |
5332279 |
T |
|
| Q |
116 |
ataatgtagagcttgcatgactacatagaattgaattgaaggact |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
5332278 |
ataatgtagagcttacatgactacatagaattgaattgagggact |
5332234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 1861837 - 1861877
Alignment:
| Q |
64 |
tatgcattgtccttattagctgagccaagctcacgaggacg |
104 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
1861837 |
tatgcattgtccatatcagctgagctaagctcacgaggacg |
1861877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 27449473 - 27449513
Alignment:
| Q |
64 |
tatgcattgtccttattagctgagccaagctcacgaggacg |
104 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
27449473 |
tatgcattgtccatattaactgagctaagctcacgaggacg |
27449513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University