View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_132 (Length: 269)
Name: NF6863A_low_132
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 43408368 - 43408104
Alignment:
| Q |
1 |
aacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatatctgaataaggacgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408368 |
aacaggtgcagatgatgactcctgctgaaggtagtggttttgagtgtgaattagggctgatctcctcctcataggtacccatatctgaataaggacgttg |
43408269 |
T |
|
| Q |
101 |
ttggatgagttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacggatgttgttggacctggatttgccctaggcccaatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408268 |
ttggatgagttctttgtgtactcttttaagtaaccaacagcaaccactaatctttctttgacagatgttgttggacctggatttgccctaggcccaatcc |
43408169 |
T |
|
| Q |
201 |
accatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408168 |
accatctcttcccaacaacaaaaccactttcctgctgatcatcatgatttgctgctggagcagtg |
43408104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University