View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_166 (Length: 252)
Name: NF6863A_low_166
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_166 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 28675602 - 28675836
Alignment:
| Q |
13 |
atggcaacaaaagagagtatgtgggacccaccaaaaacggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtggtgggt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675602 |
atggcaacaaaagagagtatgtgggacccaccaaaaagggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtggtgggt |
28675701 |
T |
|
| Q |
113 |
tgtttggaggagcgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttccttagga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675702 |
tgtttggaggagcgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttccttagga |
28675801 |
T |
|
| Q |
213 |
ttaagaacatagagttagactttgatcttgttctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675802 |
ttaagaacatagagttagactttgatcttgttctt |
28675836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 137 - 176
Target Start/End: Complemental strand, 40638148 - 40638109
Alignment:
| Q |
137 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40638148 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
40638109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University