View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_168 (Length: 251)
Name: NF6863A_low_168
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_168 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 3016169 - 3015936
Alignment:
| Q |
1 |
gatgatggatttgtcagcattttgtgattgtcttagagttagattatcatttttaagatcttacatattaatattcttctaccattgtaagtaaacaggc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
3016169 |
gatgatggatttgtcagcattttatgattgtcttagagttagattatcatttttaagatcatacatatcaatattcgtctaccgttgtaagtaaacaggc |
3016070 |
T |
|
| Q |
101 |
ttgaggaataaaaagagaaaattgaagggggnnnnnnngctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgttggaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3016069 |
ttgaggaataaaaagagaaaattgaagggggaaaaaaagctgatcaagattacagaaatcttgtgtcaactttctattacaatgttgtcatgtttgaact |
3015970 |
T |
|
| Q |
201 |
tgttctcactattattacaattccatggaaatcc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
3015969 |
tgttctcactattattacaattccatggagatcc |
3015936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University