View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_187 (Length: 249)
Name: NF6863A_low_187
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_187 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 48125954 - 48126164
Alignment:
| Q |
21 |
tcaacaacaacagctgcaaaaacagtgttagataacaaactcacgcaggctttaaatggcatgaaacaatatgtataagatttcagggagagcttttcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
48125954 |
tcaacaacaacagctgcaaaaacagtgttagataacaaactcacgcaggctttaaatggcatgaaacaatacgtataagatttcagggagaacttttcct |
48126053 |
T |
 |
| Q |
121 |
atgcagagcagggggcattacctgattcattgctgaagcaaaacgaattgtgaaatcatcatgctcagcacgaacagctccaatatgattgacaattaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48126054 |
atgcagagcagggggcattacctgattcattgctgaagcaaaacgaattgtgaaatcatcatgctcagcacgaacagctccaatatgattgacaattaga |
48126153 |
T |
 |
| Q |
221 |
taatgtctctg |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
48126154 |
taatgtctctg |
48126164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University