View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_202 (Length: 247)
Name: NF6863A_low_202
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_202 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 41 - 235
Target Start/End: Original strand, 46131 - 46325
Alignment:
| Q |
41 |
atgtatttacctcttctatcaagtagtgagagagataactcgatacttgagaagcaattggattcaatatagtaatctcttaccatgtacaactcgtctg |
140 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46131 |
atgtatttacctcttccatcaagtggtgagagagataactcaatacttgagaagcaattggattcaatatagtaatctcttaccatgtgcaactcgtctg |
46230 |
T |
|
| Q |
141 |
catgaggtgaaagctgaataatgtcaactgaatgcgattgagttacatagagccttggctaaaacctaaccttgtattgtgtacatatggatttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
46231 |
catgaggtgaaagctgaataatgtcaactgaatgcgattgagttatatagagccttggctcaaacctaaccttgtattgtgtagatatggatttt |
46325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 139 - 226
Target Start/End: Original strand, 41924928 - 41925015
Alignment:
| Q |
139 |
tgcatgaggtgaaagctgaataatgtcaactgaatgcgattgagttacatagagccttggctaaaacctaaccttgtattgtgtacat |
226 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||| | | ||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
41924928 |
tgcataaggtgaaagctgaattatgtcaactgaatgcgattaaatcgtatagagctctggctcaaacctaaccttgtattgtgtacat |
41925015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 129
Target Start/End: Original strand, 41924650 - 41924738
Alignment:
| Q |
41 |
atgtatttacctcttctatcaagtagtgagagagataactcgatacttgagaagcaattggattcaatatagtaatctcttaccatgta |
129 |
Q |
| |
|
|||| ||| |||||| ||| |||||||| | ||| |||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41924650 |
atgtctttgcctcttgcatccagtagtgaaatagacgactcaatacttgagaagcaattggattgaatgtagtaatctcttaccatgta |
41924738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University