View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_225 (Length: 243)
Name: NF6863A_low_225
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_225 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 231
Target Start/End: Original strand, 31102080 - 31102306
Alignment:
| Q |
5 |
agtatggtgttgtcacttatcatgaaaatgttcacccaaaagtgttttatattctttgtttgtctcctaataatttctcctaagttaacgctcattccaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102080 |
agtatggtgttgtcacttatcatgaaaatgttcacccaaaagtgttttatattctttgtttgtctcctaataatttctcctaagttaacgctcattccaa |
31102179 |
T |
|
| Q |
105 |
acagcgtggaaggcagaaaagtttttaccatcaacaggaaggaaaaccatttcaaaggtgaatttctctaatctcactctttgtgtattactcgaattta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31102180 |
acagcgtggaaggcagaaaagtttttaccatcaacaggaaggaaaacgatttcaaaggtgaatttctctaatctcactctttgtgttttactcgaattta |
31102279 |
T |
|
| Q |
205 |
ggatttgcctaacatgaatctcacaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31102280 |
ggatttgcctaacatgaatctcacaag |
31102306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University