View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_232 (Length: 241)
Name: NF6863A_low_232
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_232 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 12684951 - 12684745
Alignment:
| Q |
19 |
agcatcaacccattcctgcctcacatatcgacagaaatgatcgatatctggtggacgcggtctgatatccgaaacatccaccacttctttcagctgttga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12684951 |
agcatcaacccattcctgcctcacatatcgacaaaaatgatcgatatctggtggacgcggtctgatatccgaaacatctaccacttctttcagctgttga |
12684852 |
T |
|
| Q |
119 |
attaagtcatctgttttcaaggttgaatactccaccaagtactttccattttgatataaatcaacaacagttgcaggataccatgaaccttcatagcctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12684851 |
gttaagtcatctgttttcaaggttgaatactccaccaagtactttccattttgatataaatcaacaacagttgcaggataccatgaaccttcatagcctt |
12684752 |
T |
|
| Q |
219 |
gttcatc |
225 |
Q |
| |
|
||||||| |
|
|
| T |
12684751 |
gttcatc |
12684745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University