View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_242 (Length: 236)
Name: NF6863A_low_242
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_242 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 37918296 - 37918337
Alignment:
| Q |
176 |
gagaattaaggttactactagatttgatgattttggtttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37918296 |
gagaattaaggttactactagatttgatgattttggtttggt |
37918337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 37918391 - 37918430
Alignment:
| Q |
178 |
gaattaaggttactactagatttgatgattttggtttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
37918391 |
gaattaaggttactactagatttgagggttttggtttggt |
37918430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 78
Target Start/End: Original strand, 37918193 - 37918222
Alignment:
| Q |
49 |
ggtgtgagtttagatgatgcatttttggag |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37918193 |
ggtgtgagtttagatgatgcatttttggag |
37918222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University