View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_263 (Length: 231)
Name: NF6863A_low_263
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_263 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 170
Target Start/End: Complemental strand, 38720715 - 38720564
Alignment:
| Q |
19 |
gaacttgctattgaagttgcacaatgaccagacaaatttactatccccaagtcagctcctgatgatactaaaactcttagacacttctcatttttattcc |
118 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38720715 |
gaacttgatattgaagttgcataatgaccagacaaatttactatccccaagtcagctcctgatgacactaaaactcttagacacttctcatttttattcc |
38720616 |
T |
 |
| Q |
119 |
ttgtacaaatcatcaatgccgtgtcaccaaactttgtttgtgagtccaagtt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38720615 |
ttgtacaaatcatcaatgccgtgtcaccaaactttgtttgtgagtctaagtt |
38720564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University