View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6863A_low_277 (Length: 230)
Name: NF6863A_low_277
Description: NF6863A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6863A_low_277 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 211
Target Start/End: Original strand, 3884042 - 3884233
Alignment:
| Q |
20 |
cttggcatgcttctagctactgctactggaaataatctcaaaataattgatgttgggactgataaacttgtgtacaatctaaaggtaacttaaagattaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884042 |
cttggcatgcttctagctactgctactggaaataatctcaaaataattgatgttgagactgataaacttgtgtacaatctaaaggtaacttaaagattaa |
3884141 |
T |
 |
| Q |
120 |
ttcttatctatagtataccttggtacttacctttcatttcaccgcttgaatgttgtgttttgtaacatactatcataactgaattttgtttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3884142 |
ttcttatctatagtataccttggtacttacctttcatttcaccgcttgaatgttgtgttttgcaacatactatcataactgaattttgtttc |
3884233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University